View Source Bio.IO.Fasta (bio_ex_io v0.1.1)
Allow the input/output of FASTA formatted files.
The FASTA file format is composed of pairs of lines where the pair is demarcated by the ">" character. All data proceeding the ">" character represents the 'header' of the pair, while the next line after a newline represents sequence data.
Any data after subsequent newlines that are not preceded by a second ">" character are assumed to be multi-line data. For example, the following two files would be considered equivalent data:
# fasta 1
>header1
atgcatgcaand
# fasta 2
>header1
atgc
atgcaThe FASTA file format does not specify the type of the data in the sequence. That means that you can reasonably store RNA, DNA, amino acid, or any other sequence using the format. The expectation is that the data is ASCII encoded.
The methods in this module do support reading into specified types. See
read/2 for more details.
Summary
Types
Functions
Produces the same output as read!/2, but presumes that the file contents are
loaded into a binary.
@spec read(filename :: Path.t(), opts :: [read_opts()]) :: {:ok, any()} | {:error, File.posix()}
Read a FASTA formatted file
The read/2 function returns an error tuple of the content or error code from
File.read. You can use :file.format_error/1 to get a descriptive string of
the error.
You can specify the return type of the contents by using a module which
implements the Bio.Sequential or equivalent behaviour. Specifically the type
must have a new/2 function for building the struct.
The default option for the reader is a special module Bio.IO.SequenceTuple, which
will return the label and sequence as a tuple of raw binary. See
Bio.IO.SequenceTuple.new/2 for details.
Options
:type- The module for the type of struct you wish to have returned. This should minimally implement anew/2function equivalent to theBio.Sequentialbehaviour. Otherwise the baseBio.IO.SequenceTupleis used.:parse_header- A callable for parsing the header values of the FASTA file. Otherwise identity is used and the header is returned as is.
Examples
iex>Bio.IO.Fasta.read("test/fasta/test_1.fasta") {:ok, [{"header1", "ataatatgatagtagatagatagtcctatga"}]}
Read a FASTA formatted file
The same as read/2, but will raise a File.Error on failure.
@spec write(filename :: Path.t(), data :: fasta_data(), [File.mode()]) :: :ok | {:error, File.posix()}
Write a FASTA file using sequence data.
The data type that this function accepts is varied, and may be one of a number
of Lists. Examples of which types are handled:
List:
# a list of header/sequence tuples
[{header(), sequence()}, ...]
# a list of header/sequence implicitly paired
[header(), sequence(), header(), sequence(), ...]
# a list of struct()
[%Bio.Sequence._{}, ...]Where %Bio.Sequence._{} indicates any struct of the Bio.Sequence module or
modules implementing the Bio.Sequential behaviour.
It also supports data in a Map format:
%{
headers: [header(), ...],
sequences: [sequence(), ...]
}Examples
iex> Fasta.write("/tmp/test_file.fasta", ["header", "sequence", "header2", "sequence2"])
:okWill return error types in common with File.write/3